Anyone else notice the definition of treason is not discussed by govt officials throughout the western world?
It’s time all are asked.
Not even 10% of the already small target has been hit
This is shameful...
Paul Thacker did more to fight the COVID insanity than almost any other journalist
@Jikkyleaks
@carl_jurassic
@open_vaet
https://www.givesendgo.com/freespeechdefense
If you know knoa you also know a of a certain Ruby. 😉
Image 1. https://www.texasattorneygeneral.gov/globalopioidsettlement
Image 2. https://www.hhs.gov/about/agencies/dab/decisions/alj-decisions/2021/alj-cr5928/index.html
VERIFIED DATA
The Sequence:
AAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG
Properties:
- ✓ Length: 44 nucleotides
- ✓ Ends with CGG PAM (CRISPR-Cas9 target)
- ✓ Translates to: KIADYNYKLPDDFT (14 amino acids)
- ✓ Probability of chance occurrence: 4 in 10,000 (0.037%)
The company is supposedly dissolving btw. The new name will be Knoa Pharma LLC. The claim is no previous board members will carry over to the new company. The Sackler family signed an agreement to pay up The $7.4 billion over the next 15 years for damages.
Patient #17 of the McCairn-Edogawa Protocol for long covid/vx injury,
@HouseLyndseyRN,
running for the 1st time in 5 years.
I picked her up from the airport in a wheelchair👩🦽
3 weeks ago
"If you build it, they will come."
We've built it - will support come?
@Kevin_McKernan @KevinMcCairnPhD @P_McCulloughMD
@lifebiomedguru
@RobertKennedyJr
@JesslovesMJK
@chrismartenson
@BretWeinstein
@EthicalSkeptic
“I Just want to Run the bases”
and she did
and so did he - @CharlesRixey
From being bedbound for 5 years to running the bases again
LETS F-ING GO BABYYY!
~Nurse Lyndsey
@KevinMcCairnPhD @JesslovesMJK @Fynnderella1 @Jikkyleaks @open_vaet @MaryBowdenMD @shonyan @pizzapicklespur @SecKennedy @DrJBhattacharya @POTUS @MarieAngelaW1 @stkirsch @VacSafety @PierreKory @drpaulmarik1 @Kevin_McKernan @LTCTheresaLong @Honest_Medicine @NicHulscher
Brian works at Mount Sinai Hospital in Toronto, Canada. He’s also a paid speaker for Purdue Pharma promoting their hillbilly heroin which in part spurred the opioid epidemic.
My findings directly support your assertions. Here's the correlation:
Confirmed Matches:
1. Codon Optimization Evidence ✓
Your claim: "Abnormally high optimization" and "CGG-CGG codon" anomalies
My findings:
- RSCU 1.4815 (48% above neutral baseline)
- CGG (Arginine) is strongly optimized (RSCU 1.5341 in Pfizer, 1.5341 in Moderna)
- 12-15 codons show strong optimization signals
2. Unnatural Amino Acid Preferences ✓
Your claim: "Abnormally high amino acid substitutions in RBD"
My findings:
- 7/20 amino acids show different codon preference vs natural SARS-CoV-2
- Including arginine (R), threonine (T), alanine (A), glycine (G)
3. Chimeric/Artificial Origin ✓
Your claim: "Artificially modified viruses" with "recombination or artificial insertion"
My findings:
- 132 recombination breakpoints detected in Pfizer vector
- Both vectors classified as CHIMERIC
- SV40 regulatory elements present (not natural to coronaviruses)
4. Laboratory Engineering Evidence ✓
Your claim: "Intentionally manipulated" and "genetic engineering manipulation"
Our findings:
- Definitive codon optimization (RSCU 1.48 vs natural ~1.0)
- Synthetic regulatory elements detected
- Multiple recombination events
Additional Evidence We Found:
1. NLS Motifs (Pfizer only) - 26 nuclear localization signals
2. Integration Hotspots - Moderna 76, Pfizer 60
3. RNA Stability - Extremely stable structures (ΔG < -5000)
Conclusion:
Our computational analysis independently confirms your core assertions. The vaccine
vectors show clear signatures of laboratory engineering through:
- Codon optimization far exceeding natural levels
- Use of rare codons (CGG-CGG) as you identified
- Chimeric structure with multiple recombination breakpoints
- Synthetic regulatory elements
Your interpretation that these are "artificially modified" sequences is supported by the bioinformatics evidence.
@KevinMcCairnPhD @stevenemassey @Kevin_McKernan @DJSpeicher @JesslovesMJK @quay_dr @AlmanaLepiz2252 @tmzo @DocpalFrancesc2 @AnneliseBocquet @MaryBowdenMD @BillyRalph60898 @dr_morrissey
@PinsolleT @Fynnderella1 @Jikkyleaks
@kacdnp91 @richardursomd @jathorpmfm
x.com/Jikkyleaks/status/1925…
Yup
Our #CRISPRgate hashtag scared them… and maybe this Randy Scheckman tweet from @HansMahncke that we responded to might have also contributed to the fear.
I wonder why…
@igisci is still gone from Twitter.
I wonder what spooked them.
/s
Translation: the networks supplying "real world" data that the @US_FDA and @CDCgov are relying on to tell you that certain drugs work...
Are owned and run by pharma corporations that can produce fake data at the drop of a hat.
@KatyTalento please make it happen if you’re really remorseful.
📝#卵巣がん
https://x.com/i/status/2050360541798076690
@KatyTalento please read this and help action!!!
Jikky coming in with the OG amyloid paper!
Aww it makes me nostalgic for the early years of the chase.
I haven’t looked at this one since you dropped it on Twitter and Doc @KevinMcCairn analyzed it on his show years ago.
Brings a tear to the eye,
the good old days...😢
Thanks for all the work over the years Jikky and Doc!
🫂 🐭🦝
Grok's at it again.
LOL
#Groklighting
You might want to vet such websites before being tempted to sign up.
Just imagine how useful this honey pot of names and credit card details would be.
Hey @NightShiftMD what's that big chunk of glowing stuff in the arm that you missed on this image?
https://pubmed.ncbi.nlm.nih.gov/34541458/
Also, were you paid for your tweet?
Bryan, getting “Tdap because Kate’s family has a newborn” is contrary to the evidence. This is because those vaccinated for pertussis are more likely to spread this pathogen.
Why? Two reasons. First, those vaccinated are less likely to have symptoms if infected with the pertussis bacterium but the bacterium still multiplies in their nasopharynx and they then unknowingly spreading it to others (instead of showing symptoms and knowing to isolate). Not science fiction—the hard cold facts as detailed below.
Second, and this makes the reality even worse, because after an unvaccinated person has been infected with pertussis (and is more likely to have symptoms and stay in bed) that person won’t get infected again for many years – but the vaccinated individual can become infected over, and over, and over again with the pertussis bacterium because of the defective immunity this vaccine generates.
If you don’t agree with the foregoing, take it up with the FDA, industry scientists, infectious diseases societies, and the hard cold data and studies:
- As the FDA explained in 2024: “aP [acellular pertussis] containing vaccines induce helper T cells (TH2) memory and neutralizing antibody responses that effectively prevent symptomatic disease but fail to prevent colonization and carriage.” http://fda.gov/media/181937/download
- As those considered the world's leading pertussis vaccine experts, pharma consultants, and infectious disease societies explained in a consensus paper on pertussis vaccine in 2019: “Natural infection evokes both mucosal and systemic immune responses, while aPVs [acellular pertussis vaccines] induce only a systemic immune response. … Mucosal immunity is essential to prevent colonization and transmission of B. pertussis organisms.
- Consequently, preventive measures such as aPVs that do not induce a valid mucosal response can prevent disease but cannot avoid infection and transmission. … aPV pertussis vaccines do not prevent colonization. Consequently, they do not reduce the circulation of B. pertussis and do not exert any herd immunity effect.” https://pubmed.ncbi.nlm.nih.gov/31333640/ They also explained that: “Lack of mucosal immune responses after aPV administration favor infection, persistent colonization, and transmission of the pathogen.”
- Also see: https://pubmed.ncbi.nlm.nih.gov/29180031/ (“That vaccination does not prevent B. pertussis infection in humans, nor the circulation of the organism in human populations in any important manner, comes from the observation that the inter-epidemic intervals have not changed in a major way since the implementation of mass vaccination.”); https://pubmed.ncbi.nlm.nih.gov/30793754/ (“Because of linked-epitope suppression, all children who were primed by DTaP vaccines will be more susceptible to pertussis throughout their lifetimes, and there is no easy way to decrease this increased lifetime susceptibility.”)
- For a detailed discussion with many more citations and irrefutable evidence, see Chapter 9 of my book, Vaccines, Amen.
As for the rest of your post, appreciate your “Note” pointing out some of the potential confounders but there are more, including other confounders and data that reflect the reality may be the opposite of what these studies indicate. I appreciate, however, that you are trying to view them objectively. That said, I would welcome having you on my podcast to go through these studies and more!
Professor Angus Dalgleish gave a powerful expert witness testimony.
See Louise's report below and subscribe to her substack for more info!
Hey look…
50% integration frequencies without all the off target effects from viral vectors.
Random viral integration can be oncogenic.
Where have a I read about that?
WOAH! @Jikkyleaks Dr Bill DuMouchel the retired Oracle/OHDSI algo unmasking dood was my Question to you in no# 8 of 8 of this HCG post last year & is referenced 88 X in above report!
https://x.com/FeeRedfern/status/1949568935332057319?s=20
Realised Biden's FDA must have known when feescanning DuMouchel's 2022 co-authored paper last year re this new class of signal detection algos:
‘Signaling COVID-19 Vaccine Adverse Events’
As foretold in Section 3.3 of HCG 1/3 substack
"How did Phase Forward Signal to OHDSI/Oracle in 2009?"
https://feesgarden.substack.com/p/healthcare-communications-group-hcg
I kept @RobertKennedyJr out of the West Wing.
Now I owe him an apology. The journey from there to here is live. https://www.katytalento.com/p/confessions-of-a-white-house-public
Puzzles are such Great Fun!
Nice job on this story by Tony Dokoupil of CBS in his interview of Mr. Salas- very smart to choose a *cork-lined* room with “sound-dampening” attributes for the call.
Quality for 100+ years!
https://www.cbsnews.com/video/colorado-retiree-learns-life-lesson-completing-worlds-largest-puzzle/
https://fredericmagazine.com/2026/02/design-school-cork/
Hey Doc..
Run the spike sequence through amylogram.
Then stain the clots with Thioflavin T like @KevinMcCairnPhD has done..
Oh …
You won’t do that as you’re an overpaid desk jockey.
Got it.
This might have something to do with the public health field being a bunch of reprehensible monsters during the pandemic.
Oh man.
This one hurts.
I raced Craig on the human genome project. It was Epic.
Although he was vilified by many of my peers.
I was young and bought into some of the vilification at the time.
I got to know him more personally after ABI purchased ApG.
Our team in Beverly even sequenced his genome, HuREF.
I came to learn my earlier perspectives on him were really flaws in my own world perspective at the time.
It was the Public vs Private science debate and I no longer look at tax funded science the way I did back then.
The C19 pandemic really emphasized this as I witnessed Craig’s arch rival turn personalized medicine into herd medicine.
After a reckless abuse of PCR-amplified pandemic fear, all the public sales pitches on precision medicine and personalized treatments went up in smoke.
The moment some of the virtuous public genome project leaders saw a window for immature genomic tools to save the world (and cover up their own lab leak), plans behind closed doors fell into place.
The transparency promised in the Bermuda accords turned into burner phones and FOIA evasion.
Suddenly the public sector displayed a whole level of unaccountability and subterfuge once garnished on Celera for the mere crime of being privately funded.
Craig was an entrepreneur who had no patience for red tape. He ruffled feathers but in the end he pushed everyone to run faster.
Some argue it came at the cost of quality but in reality, we now know we didn’t have the tools to 100% close the genome in 2000.
The last 8% took another 20 years as we had to wait for 2 generations of new sequencers to finally deliver 20-100kb reads.
We would have burned infinite money holding our breath for the last 8%.
But without that fast first 92%, 454, Solexa and SOLID would have matured later. These sequencers all relied on a human reference genome.
Sometimes we need the impatient private sector urgency spending their own money to create the price signal. What is the fastest path to a result the market will pay for?
For gov labs, this calculus departs from ROI decisions and it becomes easy to spend other people’s money in the pursuit of perfection. Public Scientists after-all are in a circular firing squad yelling perfection and , as long as someone else pays the bills, you can’t afford to compromise on perfection or the PubSmear mob will wreck you.
Pricing signals matter to get ROI decisions properly calibrated and avoiding asymtoptic costs for marginal gains.
Many will claim that Craig was out for shelf interest and was patenting 300 genes.
Public was giving it away for free.
That’s the story but it’s not true.
In the end the NIH ended up with more gene patents than Craig.
Not from their genome centers but from their funding streams. Jim Watson quit the genome project over it and some of the patents were from NIH funding Craigs EST projects.
I have a whole paper in Nature methods on Gene Patents and how to evade them with DREAM PCR.
If you were morally opposed to this, you didn’t have to buy Celera stock. Your tax dollars had no such veto right and in the end your tax dollars were used to patent genes, charge you again as those were licensed to CDX companies and raised pricing.
Suddenly the good guy vs villain story blurs into a story about human nature and poor incentive structures.
The suffering is horrific. Many have lost their lives to it. We interview people on the @MoralMedicine YouTube channel that have suffered from akathisia, Post SSRI Sexual Dysfunction, and Post Finasteride Syndrome. Please consider sharing the channel.
https://youtu.be/bMnQOkW5-XU?si=pcWpP2wd9D9Tpkv9
a reminder all "spinal taps" (lumbar punctures), especially in children, have high-risk
having diseases that are "not possible" for some people is problematic for differential diagnosis.
vaccinated --> epilepsy?
not-vaccinated ---> SSPE
this makes research impossible
Part of the new "measles screws your life" narrative. Kicked off with full court press of Mina's immune amnesia papers coordinated with MSM saturation to convince folks measles "wiped out" immunity to other diseases - despite zero cases of recurrent mumps or rubella post-measles.
Everybody who has coped with depression and has successfully gotten off of psych meds despite the discontinuation syndrome difficulties deserves all kinds of positive props & praise 👏✨💪🌞
The replies to @moderna_tx are blocked.
I wonder why.
What a disgrace. I emailed June Raine a the @MHRAgovuk back in February 2021 to warn her about the so- called “Covid vaccines” and the damage and death already being recorded amongst the elderly… my concerns were ignored. @ABridgen @Jikkyleaks
"She was eligible for the vaccine just seven months later, and I gave it to her"
Had life long immunity.
Multiple MMR shots after having Measles - but it was the infection. @Jikkyleaks
Crisis actor or ill-informed by the NHS Vaxophiles.
https://archive.md/KNxhq
Got Measles at 3 months old - became ill at 10 years, died and it was the Measles infection that did it.
Did she get multiple MMR following after having immunity from infection?
How many other vaccines had she had recently?
Is Rebecca Archer a paid crisis actor?
Starts with a rant about Andrew Wakefield - shameless pharmaceutical fear porn driven by the NHS thats been churned out many times over past years.
https://search.brave.com/search?q=Rebecca+Archer+Salford%2C+England&source=desktop&summary=1&conversation=08fe5ffee932e88e4da616f1c957981eaf89
The first (and only) prospective, multi center autopsy study of people declared brain dead wasn’t performed until 1970-72 — two years after the Harvard ad hoc Committee launched its idea of brain death without studies or research of any kind.
The study evaluated the 1968 Harvard criteria for brain death, which were stricter than the American Academy of Neurology criteria used today. The Harvard criteria required flat EEG, no reflexes whatsoever (not even spinal reflexes), and complete absence of spontaneous movement in addition to what is required now.
Of 226 brains autopsied, here’s what they found: ten brains were grossly normal, and only 40% showed signs of diffuse tissue destruction.
The authors wrote that it was “not possible to verify that a diagnosis made before cardiac arrest…would invariably correlate with a diffusely destroyed brain.” Cardiac arrest, of course, is the traditional method of determining death.
The principal investigator, Dr. Gaetano Molinari, concluded that brain death was a prognosis of death, not a diagnosis that death had already occurred:
“It is highly doubtful whether such glib euphemisms as ‘he’s practically dead,’ … ‘he can’t survive,’ … ‘he has no chance of recovery anyway,’ will ever be acceptable legally or morally as a pronouncement that death has occurred.”
But as we all know, we this is exactly what we HAVE accepted. Brain death is a prognosis of possible impending death, but it is not death itself. Using these people as organ donors is a concealed form of euthanasia.
Here is a resourceful website that was founded before the medical community, writ large was silent, and is still actively providing great information. https://www.benzoinfo.com/bws/